First Report of Bitter Rot of Apple Caused by <i>Colletotrichum gloeosporioides</i> in Uzbekistan
Abstract
Apple (Malus domestica Borkh.) is a globally significant fruit crop, and Uzbekistan is the 11th world's largest apple producer, with an annual output of approximately 1.5 million tons. (Statista Research Department, 2025). Main apple-growing regions in Uzbekistan include the Fergana, Tashkent, Samarkand and Jizzakh, producing cultivars such as Golden Delicious, Gala, Besh Yulduz, Renet Simirenko, Red Delicious, and Starkrimson. Bitter rot, caused by Colletotrichum species, is a destructive disease of apples worldwide (Trkulja et al. 2024). In September 2025, apple (cv. Golden Delicious) fruits exhibiting typical bitter rot symptoms were sampled from a 96-ha orchard in Tashkent Province. Approximately 2000 fruits were randomly inspected across the orchard, and the disease incidence was estimated at 17 %, based on the proportion of symptomatic fruits. Initial symptoms appeared as small, circular, gray-brown lesions with reddish margins, which expanded, coalesced, and formed sunken necrotic areas exhibiting a characteristic V-shaped pattern toward the core. Symptomatic tissue fragments (1–2 mm) bearing acervuli were surface-sterilized in 0.5% NaOCl, rinsed, air-dried, and cultured on potato dextrose agar (PDA). Monoconidial cultures were obtained from symptomatic fruits, yielding five isolates from five affected specimens. Colonies were initially white, turning light gray on the surface and olivaceous gray on the reverse. Conidia were hyaline, cylindrical, straight to slightly curved, aseptate, and measured 3.8-5.7 × 11.2-16.8 µm (mean 4.7 × 14.1 µm; n = 25). Appressoria were dark brown, ovate to globose, and measured 6.2-7.3 × 10.1-12.4 µm (mean 6.7 × 11.2 µm; n = 25). These morphological and cultural characteristics were consistent with C. gloeosporioides species (Sutton 1992). For molecular identification, genomic DNA of isolate CG-AN-1 was extracted using the PureLink Genomic DNA Mini Kit and five loci (TEF1-α, TUB2, ACT, CAL, CHS) were amplified and sequenced using TEF1_new-F1 (CATCGAGAAGTTCGAGAAGG)/TEF1_new-R1 (GCCACGCAAAGGGAATTCGTA) primers designed for TEF1-α conserved regions and Bt2a/Bt2b (Glass and Donaldson, 1995), ACT-512F/ACT-783R, CAL-228F/CAL-737R, CHS-79F/CHS-354R primers (Carbone and Kohn, 1999). Sequences were deposited in GenBank under accession numbers PX630767, PX635281, PX635284, PX635282 and PX635283. BLAST analysis showed 100% identity with reference C. gloeosporioides sequences, and Neighbor-Joining phylogeny clustered CG-AN-1 with Chinese isolates. Pathogenicity was confirmed by inoculating healthy fruits (10 fruits) with 10⁵ conidia/ml. After incubation at 25 ± 2°C for 10 days, typical bitter rot symptoms developed on inoculated fruits, whereas controls remained healthy. The pathogen was reisolated and confirmed morphologically and molecularly, fulfilling Koch’s postulates. This study represents the first report of C. gloeosporioides causing bitter rot of apple in Uzbekistan. The close phylogenetic relationship with Chinese isolates suggests a possible introduction pathway probably associated with rising apple imports from China, driven by seasonal supply gaps and consumer demand for year-round and more diverse apple varieties, despite Uzbekistan’s strong domestic production. These results highlight the importance of strengthened phytosanitary surveillance to prevent the spread of this pathogen in Uzbekistan orchards.